Review



aav8 packaging vector paav2 8  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc aav8 packaging vector paav2 8
    Aav8 Packaging Vector Paav2 8, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 133 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav8+packaging+vector+paav2+8/pAAV2%2F8+(Plasmid+%23112864)/10__1161_slash_atvbaha__122__318169-109-24-28
    Average 96 stars, based on 133 article reviews
    aav8 packaging vector paav2 8 - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: Cargo-Specific Role for Retriever Subunit VPS26C in Hepatocyte Lipoprotein Receptor Recycling to Control Postprandial Triglyceride-Rich Lipoproteins
    Article Snippet: .. Using the polyethylenimine (PEI) method, this scAAV vector was transfected into HEK293T (ATCC #CRL-11268) cells, together with Adenoviral helper plasmid pAdDeltaF6 (Addgene #112867) and AAV8 packaging vector pAAV2/8 (Addgene #112864). scAAV particles were harvested 54 hours after transfection and purified overnight, using an iodixanol gradient, as previously described.46 Purified virus was aliquoted and stored at −80 °C. scAAV particles were titrated by qPCR using 2 primerprobe sets targeting spacerDNA, F1: tgaccatcatgttttattgccat, R1: tccagaatttgatcctgcatg, P1:tccaaatctgtcagcatctgggtcattc a; F2: tcgcgttgttttcttcaccttt, R2: agttaaagcagctggtggagt, P2: ccaccacttgttcctaagcggtcagc. ..

    Plasmid Preparation:

    Article Title: Cargo-Specific Role for Retriever Subunit VPS26C in Hepatocyte Lipoprotein Receptor Recycling to Control Postprandial Triglyceride-Rich Lipoproteins
    Article Snippet: .. Using the polyethylenimine (PEI) method, this scAAV vector was transfected into HEK293T (ATCC #CRL-11268) cells, together with Adenoviral helper plasmid pAdDeltaF6 (Addgene #112867) and AAV8 packaging vector pAAV2/8 (Addgene #112864). scAAV particles were harvested 54 hours after transfection and purified overnight, using an iodixanol gradient, as previously described.46 Purified virus was aliquoted and stored at −80 °C. scAAV particles were titrated by qPCR using 2 primerprobe sets targeting spacerDNA, F1: tgaccatcatgttttattgccat, R1: tccagaatttgatcctgcatg, P1:tccaaatctgtcagcatctgggtcattc a; F2: tcgcgttgttttcttcaccttt, R2: agttaaagcagctggtggagt, P2: ccaccacttgttcctaagcggtcagc. ..

    Purification:

    Article Title: Cargo-Specific Role for Retriever Subunit VPS26C in Hepatocyte Lipoprotein Receptor Recycling to Control Postprandial Triglyceride-Rich Lipoproteins
    Article Snippet: .. Using the polyethylenimine (PEI) method, this scAAV vector was transfected into HEK293T (ATCC #CRL-11268) cells, together with Adenoviral helper plasmid pAdDeltaF6 (Addgene #112867) and AAV8 packaging vector pAAV2/8 (Addgene #112864). scAAV particles were harvested 54 hours after transfection and purified overnight, using an iodixanol gradient, as previously described.46 Purified virus was aliquoted and stored at −80 °C. scAAV particles were titrated by qPCR using 2 primerprobe sets targeting spacerDNA, F1: tgaccatcatgttttattgccat, R1: tccagaatttgatcctgcatg, P1:tccaaatctgtcagcatctgggtcattc a; F2: tcgcgttgttttcttcaccttt, R2: agttaaagcagctggtggagt, P2: ccaccacttgttcctaagcggtcagc. ..

    Virus:

    Article Title: Cargo-Specific Role for Retriever Subunit VPS26C in Hepatocyte Lipoprotein Receptor Recycling to Control Postprandial Triglyceride-Rich Lipoproteins
    Article Snippet: .. Using the polyethylenimine (PEI) method, this scAAV vector was transfected into HEK293T (ATCC #CRL-11268) cells, together with Adenoviral helper plasmid pAdDeltaF6 (Addgene #112867) and AAV8 packaging vector pAAV2/8 (Addgene #112864). scAAV particles were harvested 54 hours after transfection and purified overnight, using an iodixanol gradient, as previously described.46 Purified virus was aliquoted and stored at −80 °C. scAAV particles were titrated by qPCR using 2 primerprobe sets targeting spacerDNA, F1: tgaccatcatgttttattgccat, R1: tccagaatttgatcctgcatg, P1:tccaaatctgtcagcatctgggtcattc a; F2: tcgcgttgttttcttcaccttt, R2: agttaaagcagctggtggagt, P2: ccaccacttgttcctaagcggtcagc. ..

    Real-time Polymerase Chain Reaction:

    Article Title: Cargo-Specific Role for Retriever Subunit VPS26C in Hepatocyte Lipoprotein Receptor Recycling to Control Postprandial Triglyceride-Rich Lipoproteins
    Article Snippet: .. Using the polyethylenimine (PEI) method, this scAAV vector was transfected into HEK293T (ATCC #CRL-11268) cells, together with Adenoviral helper plasmid pAdDeltaF6 (Addgene #112867) and AAV8 packaging vector pAAV2/8 (Addgene #112864). scAAV particles were harvested 54 hours after transfection and purified overnight, using an iodixanol gradient, as previously described.46 Purified virus was aliquoted and stored at −80 °C. scAAV particles were titrated by qPCR using 2 primerprobe sets targeting spacerDNA, F1: tgaccatcatgttttattgccat, R1: tccagaatttgatcctgcatg, P1:tccaaatctgtcagcatctgggtcattc a; F2: tcgcgttgttttcttcaccttt, R2: agttaaagcagctggtggagt, P2: ccaccacttgttcctaagcggtcagc. ..



    Similar Products

    aav8 packaging vector paav2 8  (Addgene inc)
    96
    Addgene inc aav8 packaging vector paav2 8
    Aav8 Packaging Vector Paav2 8, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav8+packaging+vector+paav2+8/pAAV2%2F8+(Plasmid+%23112864)/10__1161_slash_atvbaha__122__318169-109-24-28
    Average 96 stars, based on 1 article reviews
    aav8 packaging vector paav2 8 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results